Computational Phylogenetics — Liu Lab (MSU CMSE)
Phylogenetic tree construction and species delimitation: GPU-accelerated Jukes-Cantor, Kimura, GTR models. Liu lab paper reproduction in pure Rust.
Computational Phylogenetics — Liu Lab (MSU CMSE)
This notebook walks through the sequence → alignment → likelihood → tree distance → reconstruction pipeline that grounds comparative genomics validation in wetSpring. It emphasizes five core models inline below; the broader Track 1b surface is twelve Python baseline scripts in scripts/ (each with a matching validate_* binary). Topics span hidden Markov models for phylogenomic heterogeneity (PhyloNet-HMM / Liu 2014), pairwise local alignment with affine gaps (Smith–Waterman), Felsenstein pruning under Jukes–Cantor, Robinson–Foulds tree comparison, and neighbor-joining guide trees (SATé / Liu 2009).
| # | Topic | DOI | Model |
|---|---|---|---|
| 1 | Liu et al. 2014 (PhyloNet-HMM framing) | 10.1371/journal.pcbi.1003649 | 3-state emission HMM: forward + Viterbi |
| 2 | Smith & Waterman 1981 | 10.1016/0022-2836(81)90087-5 | Affine-gap local alignment |
| 3 | Felsenstein 1981 | 10.1007/BF01734359 | Pruning + JC69 transition probabilities |
| 4 | Robinson–Foulds | Consensus usage in phylogenetics | Unrooted bipartition distance |
| 5 | Liu et al. 2009 (SATé) | 10.1126/science.1171243 | Neighbor-joining from distances |
Rust validation (Track 1b, 12 scripts): validate_newick_parse (019), validate_rf_distance (021), validate_hmm (026), validate_alignment (028), validate_felsenstein (029), validate_bootstrap (031), validate_placement (032), validate_neighbor_joining (033), validate_reconciliation (034), validate_phynetpy_rf (036), validate_phylohmm (037), validate_sate_pipeline (038).
For other springs: swap the organismal story for your domain but keep this publishable scaffold — math spec → pure-Python replicate → matplotlib figures → frozen JSON under experiments/results/ → optional Tier-2 IPC.
import os, json, struct, socket, math
from pathlib import Path
import numpy as np
from scipy.integrate import odeint
RESULTS = Path('..') / '..' / 'experiments' / 'results'
def load(name):
with open(RESULTS / name) as f:
return json.load(f)
TIER = 'frozen'
IPC_SOCKET = os.environ.get('WETSPRING_IPC_SOCKET')
def ipc_call(method, params=None):
sock = socket.socket(socket.AF_UNIX, socket.SOCK_STREAM)
sock.connect(IPC_SOCKET)
req = json.dumps({'jsonrpc': '2.0', 'method': method, 'params': params or {}, 'id': 1})
payload = req.encode()
sock.sendall(struct.pack('<I', len(payload)) + payload)
length = struct.unpack('<I', sock.recv(4))[0]
data = sock.recv(length)
sock.close()
return json.loads(data)['result']
if IPC_SOCKET and os.path.exists(IPC_SOCKET):
try:
ipc_call('health.check')
TIER = 'live_ipc'
print(f'Tier 2 ACTIVE — live IPC via {IPC_SOCKET}')
except Exception:
print('Tier 2 socket found but not responding — using frozen data')
else:
print(f'Tier 1 — frozen data (no IPC socket)')
import matplotlib
import matplotlib.pyplot as plt
PASS_COLOR = '#2ecc71'
FAIL_COLOR = '#e74c3c'
INFO_COLOR = '#3498db'
def hill(x, k, n):
"""Hill activation: x^n / (k^n + x^n)."""
return x**n / (k**n + x**n) if x > 0 else 0.0
def hill_repress(x, k, n):
"""Hill repression: k^n / (k^n + x^n)."""
return k**n / (k**n + x**n) if x > 0 else 1.0
1. Liu 2014 — 3-state HMM (forward + Viterbi)
Hidden states (q_t \in {0,1,2}) emit symbols (o_t \in {0,1,2}) through row-stochastic B. Markov transitions use A; initial distribution (\pi).
Forward (dynamic programming): (\alpha_t(j) = P(o_1,\ldots,o_t, q_t=j) = b_j(o_t) \sum_i \alpha_{t-1}(i), a_{ij}), with (\alpha_1(j) = \pi_j, b_j(o_1)).
Viterbi (max-product): (\delta_t(j) = b_j(o_t) \max_i \delta_{t-1}(i), a_{ij}), backtrace for (\arg\max) path.
Below: fixed (\pi), A, B, and the observation trace from this notebook specification; visualize the forward lattice and decode the MAP path.
pi = np.array([0.6, 0.3, 0.1], dtype=float)
A = np.array([[0.7, 0.2, 0.1], [0.1, 0.6, 0.3], [0.2, 0.3, 0.5]], dtype=float)
B = np.array([[0.5, 0.3, 0.2], [0.1, 0.4, 0.5], [0.3, 0.3, 0.4]], dtype=float)
obs = np.array([0, 1, 0, 2, 1, 0, 1, 2, 0, 1], dtype=int)
n_states = 3
T = len(obs)
alpha = np.zeros((T, n_states))
alpha[0] = pi * B[:, obs[0]]
for t in range(1, T):
for j in range(n_states):
alpha[t, j] = B[j, obs[t]] * np.sum(alpha[t - 1] * A[:, j])
log_lik = math.log(alpha[-1].sum())
delta = np.zeros((T, n_states))
psi = np.zeros((T, n_states), dtype=int)
delta[0] = np.log(pi + 1e-300) + np.log(B[:, obs[0]] + 1e-300)
for t in range(1, T):
for j in range(n_states):
scores = delta[t - 1] + np.log(A[:, j] + 1e-300)
psi[t, j] = int(np.argmax(scores))
delta[t, j] = np.log(B[j, obs[t]] + 1e-300) + scores[psi[t, j]]
path = [0] * T
path[-1] = int(np.argmax(delta[-1]))
viterbi_logp = float(delta[-1, path[-1]])
for t in range(T - 1, 0, -1):
path[t - 1] = psi[t, path[t]]
fig, axes = plt.subplots(1, 2, figsize=(14, 4))
ax = axes[0]
im = ax.imshow(np.log(alpha.T + 1e-300), aspect='auto', cmap='viridis')
ax.set_xlabel('time t'); ax.set_ylabel('state j')
ax.set_title('log forward lattice log α_t(j)')
plt.colorbar(im, ax=ax)
ax = axes[1]
ax.step(np.arange(T), path, where='mid', color=INFO_COLOR, linewidth=2)
ax.scatter(np.arange(T), path, color=FAIL_COLOR, zorder=3)
ax.set_xlabel('t'); ax.set_ylabel('Viterbi state'); ax.set_yticks([0, 1, 2])
ax.set_title('Viterbi path'); ax.grid(alpha=0.3)
plt.suptitle('Liu 2014 HMM — forward likelihood + Viterbi decoding', fontweight='bold')
plt.tight_layout(); plt.show()
print(f'log P(obs) = {log_lik:.6f}')
print(f'Viterbi path = {path}')
print(f'Viterbi log prob (max joint) = {viterbi_logp:.6f}')
2. Smith & Waterman 1981 — affine-gap local alignment
Local alignment score with match (=2), mismatch (=-1), gap open (=-3), gap extend (=-1) (Gotoh recurrence; scores floored at 0 for locality, as in wetSpring validation).
def smith_waterman(query, target, match=2, mismatch=-1, gap_open=-3, gap_extend=-1):
m, n = len(query), len(target)
if m == 0 or n == 0:
return {"score": 0, "aligned_query": "", "aligned_target": "", "query_start": 0, "target_start": 0}
H = [[0] * (n + 1) for _ in range(m + 1)]
E = [[-(10**9)] * (n + 1) for _ in range(m + 1)]
F = [[-(10**9)] * (n + 1) for _ in range(m + 1)]
best_score, best_i, best_j = 0, 0, 0
for i in range(1, m + 1):
for j in range(1, n + 1):
s = match if query[i - 1].upper() == target[j - 1].upper() else mismatch
E[i][j] = max(H[i][j - 1] + gap_open + gap_extend, E[i][j - 1] + gap_extend)
F[i][j] = max(H[i - 1][j] + gap_open + gap_extend, F[i - 1][j] + gap_extend)
H[i][j] = max(0, H[i - 1][j - 1] + s, E[i][j], F[i][j])
if H[i][j] > best_score:
best_score, best_i, best_j = H[i][j], i, j
aq, at = [], []
i, j = best_i, best_j
while i > 0 and j > 0 and H[i][j] > 0:
s = match if query[i - 1].upper() == target[j - 1].upper() else mismatch
if H[i][j] == H[i - 1][j - 1] + s:
aq.append(query[i - 1]); at.append(target[j - 1]); i -= 1; j -= 1
elif H[i][j] == F[i][j]:
aq.append(query[i - 1]); at.append('-'); i -= 1
else:
aq.append('-'); at.append(target[j - 1]); j -= 1
return {
"score": best_score,
"aligned_query": ''.join(reversed(aq)),
"aligned_target": ''.join(reversed(at)),
"query_start": i,
"target_start": j,
}
cases = {
"identical": ("ACGTACGT", "ACGTACGT"),
"mismatch": ("ACGT", "ACTT"),
"gap": ("ACGTACGT", "ACGACGT"),
"local": ("XXXACGTACGTXXX", "ACGTACGT"),
"16s_fragment": (
"GATCCTGGCTCAGGATGAACGCTGGCGGCGTGCCTAATAC",
"GATCCTGGCTCAGAATGAACGCTGGCGGCATGCCTAATAC",
),
}
scores = {k: smith_waterman(*v)["score"] for k, v in cases.items()}
fig, ax = plt.subplots(figsize=(11, 4))
labs = list(scores.keys())
vals = [scores[k] for k in labs]
cols = [INFO_COLOR if i % 2 == 0 else PASS_COLOR for i in range(len(labs))]
bars = ax.bar(labs, vals, color=cols)
ax.set_ylabel('SW score'); ax.set_title('Smith–Waterman — scenario scores')
for b, v in zip(bars, vals):
ax.text(b.get_x() + b.get_width() / 2, v + 0.5, str(v), ha='center', fontsize=9)
ax.grid(alpha=0.3, axis='y')
plt.tight_layout(); plt.show()
for k in labs:
r = smith_waterman(*cases[k])
print(f'{k:12s} score={r["score"]:3d} q@{r["query_start"]} t@{r["target_start"]}')
3. Felsenstein 1981 — pruning under Jukes–Cantor
For rate (\mu) and edge length (t), JC69 gives (P_{ii}(t)=\tfrac{1}{4}+\tfrac{3}{4}\exp(-4\mu t/3)) and (P_{ij}(t)=\tfrac{1}{4}(1-\exp(-4\mu t/3))) for (i\neq j).
Likelihood: post-order pruning with partials at each node; multiply root partials by (\pi_k=\tfrac14).
Tree (Newick): ((A:0.1, C:0.1):0.2, (G:0.1, T:0.1):0.2):0 with leaf strings ACGT, ACTT, GCGT, GCAT.
N_STATES = 4
def jc69_prob(fr, to, branch_len, mu=1.0):
e = math.exp(-4 * mu * branch_len / 3)
return (0.25 + 0.75 * e) if fr == to else 0.25 * (1 - e)
def transition_matrix(branch_len, mu=1.0):
return [[jc69_prob(i, j, branch_len, mu) for j in range(N_STATES)] for i in range(N_STATES)]
def encode_dna(seq):
m = {'A': 0, 'C': 1, 'G': 2, 'T': 3}
return [m[c.upper()] for c in seq]
def leaf_partial(state):
p = [0.0] * N_STATES
p[state] = 1.0
return p
def pruning(tree, mu=1.0):
if tree["type"] == "leaf":
return [[*leaf_partial(s)] for s in tree["states"]]
left_p = pruning(tree["left"], mu)
right_p = pruning(tree["right"], mu)
trans_l = transition_matrix(tree["left_branch"], mu)
trans_r = transition_matrix(tree["right_branch"], mu)
partials = []
for lp, rp in zip(left_p, right_p):
result = [0.0] * N_STATES
for s in range(N_STATES):
ls = sum(trans_l[s][x] * lp[x] for x in range(N_STATES))
rs = sum(trans_r[s][x] * rp[x] for x in range(N_STATES))
result[s] = ls * rs
partials.append(result)
return partials
def site_log_likelihoods(tree, mu=1.0):
partials = pruning(tree, mu)
pi = 0.25
return [math.log(pi * sum(p[s] for s in range(N_STATES))) for p in partials]
fel_tree = {
"type": "internal",
"left": {
"type": "internal",
"left": {"type": "leaf", "name": "A", "states": encode_dna("ACGT")},
"right": {"type": "leaf", "name": "C", "states": encode_dna("ACTT")},
"left_branch": 0.1, "right_branch": 0.1,
},
"right": {
"type": "internal",
"left": {"type": "leaf", "name": "G", "states": encode_dna("GCGT")},
"right": {"type": "leaf", "name": "T", "states": encode_dna("GCAT")},
"left_branch": 0.1, "right_branch": 0.1,
},
"left_branch": 0.2, "right_branch": 0.2,
}
sll = site_log_likelihoods(fel_tree, 1.0)
ll = sum(sll)
fig, ax = plt.subplots(figsize=(10, 4))
ax.bar(np.arange(1, len(sll) + 1), sll, color=INFO_COLOR, edgecolor='white')
ax.set_xlabel('site'); ax.set_ylabel('log site likelihood')
ax.set_title('Felsenstein pruning — per-site log-likelihoods (JC69, μ=1)')
ax.grid(alpha=0.3, axis='y')
plt.tight_layout(); plt.show()
print(f'total log L = {ll:.6f}')
print('site log L:', [round(x, 4) for x in sll])
4. Robinson–Foulds distance
Summarize each unrooted fully resolved tree by its non-trivial bipartitions — for four taxa only the central split matters (alternatives AB|CD, AC|BD, AD|BC). The Robinson–Foulds metric counts edges that must appear in exactly one reconstruction (equivalently, split symmetric difference).
Example (Exp021 single_nni_4leaf):
T1 = ((A:0.1,B:0.2):0.3,(C:0.3,D:0.4):0.5);
T2 = ((A:0.1,C:0.3):0.3,(B:0.2,D:0.4):0.5);
Here T1 encodes AB|CD; T2 encodes AC|BD; (\mathrm{RF}(T_1,T_2)=2).
def canon_split(side, labels):
side = frozenset(side)
other = frozenset(labels) - side
if not side or not other:
return None
a, b = side, other
if len(a) > len(b) or (len(a) == len(b) and min(a) > min(b)):
a, b = b, a
return frozenset(a), frozenset(b)
labels4 = {'A', 'B', 'C', 'D'}
S1 = {canon_split({'A', 'B'}, labels4)}
S2 = {canon_split({'A', 'C'}, labels4)}
rf = len(S1.symmetric_difference(S2))
newick1 = '((A:0.1,B:0.2):0.3,(C:0.3,D:0.4):0.5);'
newick2 = '((A:0.1,C:0.3):0.3,(B:0.2,D:0.4):0.5);'
fig, axes = plt.subplots(1, 2, figsize=(14, 3.5))
for ax, nw, title in zip(axes, [newick1, newick2], ['T1', 'T2']):
ax.axis('off')
ax.set_title(title, fontweight='bold', loc='left')
ax.text(0.02, 0.55, nw, family='monospace', fontsize=10, va='center')
plt.suptitle('Robinson–Foulds quartet example (Newick)', fontweight='bold')
plt.tight_layout(); plt.show()
s1, s2 = list(S1)[0], list(S2)[0]
print(f'T1 nontrivial split (canonical): {sorted(s1[0])}|{sorted(s1[1])}')
print(f'T2 nontrivial split (canonical): {sorted(s2[0])}|{sorted(s2[1])}')
print(f'RF distance = {rf} (symmetric split difference; Exp021 NNI case)')
5. Neighbor-Joining — Liu 2009 (SATé primitive)
Neighbor-Joining minimizes the neighbor criterion (Q) (Saitou & Nei) and iteratively merges taxa — the guide tree backbone of SATé (Liu 2009) when fed a pairwise divergence matrix (d_{ij}).
Below: the (5\times5) JC distance matrix from liu2009_neighbor_joining.py (same synthetic contigs). We plot the matrix then emit a Newick string from a pure NumPy/Python NJ port.
def neighbor_joining(dist_matrix, labels):
n_orig = len(dist_matrix)
D = [row[:] for row in dist_matrix]
active = list(range(n_orig))
node_labels = list(labels)
next_node = n_orig
while len(active) > 2:
r = len(active)
row_sums = {}
for i in active:
row_sums[i] = sum(D[i][j] for j in active if j != i)
best_q = float('inf'); best_i, best_j = active[0], active[1]
for ai, i in enumerate(active):
for j in active[ai + 1 :]:
q_val = (r - 2) * D[i][j] - row_sums[i] - row_sums[j]
if q_val < best_q:
best_q = q_val; best_i, best_j = i, j
if r > 2:
delta = (row_sums[best_i] - row_sums[best_j]) / (r - 2)
else:
delta = 0.0
li = max(0.0, 0.5 * (D[best_i][best_j] + delta))
lj = max(0.0, 0.5 * (D[best_i][best_j] - delta))
new_label = f'({node_labels[best_i]}:{li:.6f},{node_labels[best_j]}:{lj:.6f})'
node_labels.append(new_label)
new_idx = next_node; next_node += 1
while len(D) <= new_idx:
D.append([0.0] * len(D[0]))
for row in D:
while len(row) <= new_idx:
row.append(0.0)
for k in active:
if k not in (best_i, best_j):
d_new = 0.5 * (D[best_i][k] + D[best_j][k] - D[best_i][best_j])
D[new_idx][k] = d_new
D[k][new_idx] = d_new
D[new_idx][new_idx] = 0.0
active.remove(best_i); active.remove(best_j); active.append(new_idx)
i, j = active
final_d = D[i][j]
return f'({node_labels[i]}:{final_d / 2:.6f},{node_labels[j]}:{final_d / 2:.6f});'
def jukes_cantor_distance(seq1, seq2):
diffs = sum(1 for a, b in zip(seq1, seq2) if a != b)
p = diffs / len(seq1)
if p >= 0.75:
return 10.0
return -0.75 * math.log(1.0 - 4.0 * p / 3.0)
seqs = {
'S1': 'ACGTACGTACGT',
'S2': 'ACGTACGTACTT',
'S3': 'ACTTACTTACTT',
'S4': 'TGCATGCATGCA',
'S5': 'TGCATGCATGCC',
}
labels_5 = list(seqs.keys())
n = len(labels_5)
D5 = [[0.0] * n for _ in range(n)]
for i in range(n):
for j in range(i + 1, n):
d = jukes_cantor_distance(seqs[labels_5[i]], seqs[labels_5[j]])
D5[i][j] = d; D5[j][i] = d
fig, axes = plt.subplots(1, 2, figsize=(13, 4.5))
ax = axes[0]
im = ax.imshow(D5, cmap='viridis')
ax.set_xticks(range(n)); ax.set_yticks(range(n))
ax.set_xticklabels(labels_5); ax.set_yticklabels(labels_5)
ax.set_title('5×5 Jukes–Cantor distance matrix')
plt.colorbar(im, ax=ax)
ax = axes[1]
ax.axis('off')
nw = neighbor_joining(D5, labels_5)
ax.text(0.02, 0.5, 'NJ Newick:\n' + nw, family='monospace', fontsize=9, va='center')
ax.set_title('Neighbor-joining tree')
plt.suptitle('Liu 2009 SATé — NJ from distances', fontweight='bold')
plt.tight_layout(); plt.show()
print(nw)
Rust parity — frozen baselines
Load JSON recorded under experiments/results/. Canonical paths in this repository: 026_hmm/, 028_alignment/, 029_felsenstein/, 021_rf_baseline/ (aliases in the loader below map the names from the wetSpring experiment index).
def resolve_result(*candidates):
for c in candidates:
p = RESULTS / c
if p.exists():
return p, c
raise FileNotFoundError('None found: ' + ', '.join(candidates))
p_hmm, _ = resolve_result(
'026_hmm/liu2014_hmm_python_baseline.json',
)
p_sw, _ = resolve_result(
'028_smith_waterman/sw_python_baseline.json',
'028_alignment/smith_waterman_python_baseline.json',
)
p_fel, _ = resolve_result(
'029_pruning/felsenstein_python_baseline.json',
'029_felsenstein/felsenstein_python_baseline.json',
)
p_rf, _ = resolve_result(
'021_rf_distance/rf_distance_python_baseline.json',
'021_rf_baseline/rf_python_baseline.json',
)
frozen_hmm = json.load(open(p_hmm))
frozen_sw = json.load(open(p_sw))
frozen_fel = json.load(open(p_fel))
frozen_rf = json.load(open(p_rf))
print('Frozen baseline paths resolved:')
print(f' HMM → {p_hmm.relative_to(RESULTS)}')
print(f' Smith–Waterman → {p_sw.relative_to(RESULTS)} (requested `028_smith_waterman/…` falls back here)')
print(f' Felsenstein → {p_fel.relative_to(RESULTS)}')
print(f' RF distance → {p_rf.relative_to(RESULTS)}')
print()
print('Frozen check / case counts:')
print(f' liu2014_hmm scenarios: {len(frozen_hmm)} top-level buckets')
genomic = frozen_hmm.get('genomic_3state', {})
if genomic:
print(f' genomic_3state: logL={genomic.get("log_likelihood")}, Viterbi len={len(genomic.get("viterbi_path", []))}')
print(f' smith_waterman cases: {len(frozen_sw)}')
print(f' felsenstein cases: {len(frozen_fel)}')
print(f' RF baseline: PASS {frozen_rf.get("total_pass")} / CASES {frozen_rf.get("total_cases")}')
Tier 2 IPC parity — science.alignment
When WETSPRING_IPC_SOCKET is live, call the Rust Smith–Waterman handler and compare to the frozen identical scenario (Exp028). Parameters use seq_a / seq_b per the IPC schema.
if TIER == 'live_ipc':
live = ipc_call('science.alignment', {
'seq_a': 'ACGTACGT',
'seq_b': 'ACGTACGT',
'match_score': 2,
'mismatch_penalty': -1,
'gap_open': -3,
'gap_extend': -1,
})
# reload SW path for frozen identical score
p_sw, _ = resolve_result(
'028_smith_waterman/sw_python_baseline.json',
'028_alignment/smith_waterman_python_baseline.json',
)
frozen_sw = json.load(open(p_sw))
exp = frozen_sw['identical']['score']
assert live['score'] == exp, (live['score'], exp)
print(f'Tier 2 parity: science.alignment MATCH (score={live["score"]})')
else:
print('Tier 2 IPC skipped (Tier 1 frozen mode).')
Validation summary
| # | Python script | Exp | Rust binary |
|---|---|---|---|
| 1 | newick_parse_baseline.py | 019 | validate_newick_parse |
| 2 | rf_distance_baseline.py | 021 | validate_rf_distance |
| 3 | liu2014_hmm_baseline.py | 026 | validate_hmm |
| 4 | smith_waterman_baseline.py | 028 | validate_alignment |
| 5 | felsenstein_pruning_baseline.py | 029 | validate_felsenstein |
| 6 | wang2021_rawr_bootstrap.py | 031 | validate_bootstrap |
| 7 | alamin2024_placement.py | 032 | validate_placement |
| 8 | liu2009_neighbor_joining.py | 033 | validate_neighbor_joining |
| 9 | zheng2023_dtl_reconciliation.py | 034 | validate_reconciliation |
| 10 | phynetpy_rf_baseline.py | 036 | validate_phynetpy_rf |
| 11 | phylohmm_introgression_baseline.py | 037 | validate_phylohmm |
| 12 | sate_alignment_baseline.py | 038 | validate_sate_pipeline |
Provenance: Parameters and seeds follow the published references above; wetSpring stores Python baselines as JSON under experiments/results/ with matching Rust harnesses in barracuda/.
Evolution: Tier 1 — this notebook + frozen baselines. Tier 2 — live IPC (science.alignment shown here; other methods map to additional handlers). Tier 3 — primal composition with provenance sessions wrapping each experiment slice.